ppGpp

•

Rfam ID: nan (nan)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:

Timeline Description Structure&recognition References


Timeline

Start

    2004[1] Identification of ykkC motif that exhibit characteristics of riboswitch function

    Separation of ykkC subtype 2 2017[2]

    2018[3] Further classification of ykkC subtype 2 as subtypes 2a through 2d

    Validation of ykkC subtype 2a as ppGpp riboswitch 2018[4]

    2018[5] Crystal structures of the ppGpp riboswitch bound to ppGpp

    Monitor cellular ppGpp accumulation by ppGpp-specific riboswitch binding to fluorescent RNA aptamers 2021[6]
2023...



Description

 ppGpp riboswitch form a class of riboswitch that specifically bind guanosine tetraphosphate(ppGpp),which is a well-known alarmone produced during various stresses including stringent response,causing by a shortage of amino acids. ppGpp acts on many levels and affects replication,transcription and translation.ppGpp riboswitch were originally identified by bioinformatics as a conserved RNA-like structure called the "The ykkC motif"，which was proposed to represent the highly-conserved aptamer domain of a riboswitch candidate. ykkC RNAs have been organized into at least four major categories called subtypes 2a through 2d. Subtype 2a RNAs are riboswitches that sense the bacterial alarmone ppGpp, and typically regulate amino acid biosynthesisgenes.ppGpp riboswitches control genes involved in biosynthesis and transport of branched-chain amino acids and genes encoding for glutamate synthase and The ATP-binding cassette transporters（ABC transporters）.


Gene association

The figure depicts genes regulated by ppGpp riboswitch predicted in Firmicutes[4].
drawing


Gene regulation

Potential mechanism of the ppGpp riboswitch for controlling gene expression in Sulfobacillus acidophilus. The guanosine tetraphosphate (ppGpp) is showed on red. We present the prototypical mechanism, but not all possible mechanisms[5].
drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the ppGpp riboswitch. Bottom: Secondary structure depictions of the Sulfobacillus acidophilus ppGpp riboswitch according to PDB ID: 6DMC. The molecule of the guanosine tetraphosphate (ppGpp) observed in the crystal structure are denoted in red[5].

5'GGAAGUGUACCUAGGGAUCCACCUCGAGAGAGGAAGGACCAAGCGGUACAGGCCUACUUCGGUAGGUUACACCGUGGGGAUAAAAGACCCGUGGCAAGUUUC3' (Sequence from bottom structure )


3D visualisation

The overall structure of the Sulfobacillus acidophilus ppGpp riboswitch was generated from PDB ID: 6DMC at 2.20 Å resolution bound with 6S-ppGpp. 6S-ppGpp (shown in sticks) is colored in red. Additional available structures that have been solved and detailed information are accessible on Structures page [5].

(Clicking the "Settings/Controls info" to turn Spin off)      
drawing PDBe Molstar






Binding pocket

Left: Surface representation of the binding pocket of the Geobacter ppGpp riboswitch generated from PDB ID: 6DMC at 2.20 Å resolution. 6S-ppGpp (6S-ppGpp) (shown in sticks) is labeled in red. Right: The hydrogen bond of binding sites of the ppGpp riboswitch bound with 6S-ppGpp[5].
drawing drawing


Ligand recognition

Chemical structures of guanosine tetraphosphate(ppGpp) and its analogs. The apparent KD of each compound of ppGpp riboswitch is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[5].
drawing



References

[1] New RNA motifs suggest an expanded scope for riboswitches in bacterial genetic control.
Barrick, J. E. et al.
Proc. Natl. Acad. Sci. U. S. A. 101, 6421–6426 (2004).

[2] Metabolism of Free Guanidine in Bacteria Is Regulated by a Widespread Riboswitch Class.
Nelson, J. W., Atilho, R. M., Sherlock, M. E., Stockbridge, R. B. & Breaker, R. R.
Mol. Cell 65, 220–230 (2017).

[3] Tandem riboswitches form a natural Boolean logic gate to control purine metabolism in bacteria.
Sherlock, M. E., Sudarsan, N., Stav, S. & Breaker, R. R.
Elife 7, (2018).

[4] Riboswitches for the alarmone ppGpp expand the collection of RNA-based signaling systems.
Sherlock, M. E., Sudarsan, N. & Breaker, R. R.
Proc. Natl. Acad. Sci. U. S. A. 115, 6052–6057 (2018).

[5] ykkC riboswitches employ an add-on helix to adjust specificity for polyanionic ligands.
Peselis, A. & Serganov, A.
Nat. Chem. Biol. 14, 887–894 (2018).

[6] Live-Cell Imaging of Guanosine Tetra- and Pentaphosphate (p)ppGpp with RNA-based Fluorescent Sensors*.
Sun, Z. et al.
Angew. Chem. Int. Ed Engl. 60, 24070–24074 (2021).