c-AMP-GMP

•

Rfam ID: nan (nan)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:

Timeline Description Structure&recognition References


Timeline

Start

    2007[1] Discovery of GEMM motif

    Discovery of cGAMP riboswitch 2015[2]

    2015[3] Structure of cGAMP riboswitch

    Visualization of cAG signaling in live bacteria using the GEMM Ib riboswitch (cGAMP riboswitch) 2015[4]

    2018[5] Adenine protonation enables cyclic-di-GMP binding to cyclic-GAMP sensing riboswitches

    Structural features of 3', 3'-cGAMP ligand-induced 3', 3'-cGAMP riboswitches and specificity of ligand recognition 2018[6]

    2022[7] The Signaling Pathway That cGAMP Riboswitches Found
2023...



Description

 c-AMP-GMP riboswitch (also known as c-GAMP riboswitch) form a class of ribose switches that bind specifically to cyclic AMP-GMP. Previously annotated as the c-di-GMP-I ribose switch, its mutant cyclic AMP-GMP riboswitch is able to bind to a second messenger, c-AMP-GMP. The cyclic AMP-GMP ribose switch recognizes c-AMP-GMP and controls a group of genes important for utilizing iron oxide (III) in external power generation.Approximately 6,800 sequences conform to the c-di-GMP-I riboswitch class consensus , which was formerly called the Genes for the Environment, for Membranes and for Motility (GEMM) motif .Predominantly found in species of Bacillales, Clostridia, Deltaproteobacteria, and Gammaproteobacteria , the vastmajority have aptamer sequences and gene associations that aretypical for c-di-GMP binding and control.


Gene association

The figure depicts genes regulated by c-AMP-GMP riboswitch predicted in Deltaproteobacteria[2].
drawing


Gene regulation

Potential mechanism of the c-AMP-GMP riboswitch for controlling gene expression in Geobacter bacteria. The ribosome binding site (c-AMP-GMP) is showed on red. We present the prototypical mechanism, but not all possible mechanisms[4].
drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the c-AMP-GMP riboswitch. Bottom: Secondary structure depictions of the Geobacter c-AMP-GMP riboswitch according to PDB ID: 4YAZ. The molecule of the mixed purine cyclic dinucleotide cyclic GMP-AMP (c-AMP-GMP) observed in the crystal structure are denoted in red[3].

5'GGUACACGACAAUACUAAACCAUCCGCGAGGAUGGGGCGGAAAGCCUAAGGGUCUCCCUGAGACAGCCGGGCUGCCGAAAUAUC3' (Sequence from bottom structure )


3D visualisation

The overall structure of the Geobacter c-AMP-GMP riboswitch was generated from PDB ID: 4YAZ at 2.00 Å resolution bound with 6S-c-AMP-GMP. 6S-c-AMP-GMP (shown in sticks) is colored in red. Additional available structures that have been solved and detailed information are accessible on Structures page [3].

(Clicking the "Settings/Controls info" to turn Spin off)      
drawing PDBe Molstar






Binding pocket

Left: Surface representation of the binding pocket of the Geobacter c-AMP-GMP riboswitch generated from PDB ID: 4YAZ at 2.00 Å resolution. 6S-c-AMP-GMP (6S-c-AMP-GMP) (shown in sticks) is labeled in red. Right: The hydrogen bond of binding sites of the c-AMP-GMP riboswitch bound with 6S-c-AMP-GMP[3].
drawing drawing


Ligand recognition

Chemical structures of the mixed purine cyclic dinucleotide cyclic GMP-AMP (3', 3' c-AMP-GMP) and its analogs:Cyclic diadenylate(c-di-AMP) and cyclic diguanylate (c-di-GMP). The apparent KD of each compound of c-AMP-GMP riboswitch is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[3].
drawing



References

[1] Identification of 22 candidate structured RNAs in bacteria using the CMfinder comparative genomics pipeline.
Weinberg, Z. et al.
Nucleic Acids Res. 35, 4809–4819 (2007).

[2] Control of bacterial exoelectrogenesis by c-AMP-GMP.
Nelson, J. W. et al.
Proc. Natl. Acad. Sci. U. S. A. 112, 5389–5394 (2015).

[3] Structural basis for molecular discrimination by a 3',3'-cGAMP sensing riboswitch.
Ren, A. et al.
Cell Rep. 11, 1–12 (2015).

[4] GEMM-I riboswitches from Geobacter sense the bacterial second messenger cyclic AMP-GMP.
Kellenberger, C. A. et al.
Proc. Natl. Acad. Sci. U. S. A. 112, 5383–5388 (2015).

[5] Adenine protonation enables cyclic-di-GMP binding to cyclic-GAMP sensing riboswitches.
Keller, H., Weickhmann, A. K., Bock, T. & Wöhnert, J.
RNA 24, 1390–1402 (2018).

[6] Structural Studies of the 3',3'-cGAMP Riboswitch Induced by Cognate and Noncognate Ligands Using Molecular Dynamics Simulation.
Li, C., Zhao, X., Zhu, X., Xie, P. & Chen, G.
Int. J. Mol. Sci. 19, (2018).

[7] The Signaling Pathway That cGAMP Riboswitches Found: Analysis and Application of Riboswitches to Study cGAMP Signaling in Geobacter sulfurreducens.
Tan, Z. et al.
Int. J. Mol. Sci. 23, (2022).