SAM-III

•

Rfam ID: RF01767 (SMK box translational riboswitch (SAM-III))


Horizontally arranged click buttons

Click the buttons to navigate to different sections:

Timeline Description Structure&recognition References


Timeline

Start

    2006[1] Discovered and named SMK box, the S(MK) box represents a new SAM-binding riboswitch

    Translation control mechanism about S(MK)/SAM-III riboswitch 2007[2]

    2008[3] Crystal structures of the SAM-III/S(MK) riboswitch

    Atomic level understanding of the ligand recognition mechanism of SAM-III riboswitch 2010[4]

    2010[5] S(MK) box is a reversible riboswitch

    Probe the ligand-induced conformational switching mechanism of SAM-III riboswitch 2011[6]

    2016[8] Provides a detailed understanding of folded structures of the SAM-III riboswitch in the presence and absence of the ligand, respectively

    Gaussian-accelerated molecular dynamics simulations were performed to decipher the identification mechanisms of SAM-III (SMK) on ligands SAM, SAH, and EEM 2022[10]

    2023[11] This review summarizes the current research progress on these SAM-related riboswitch families
2023...



Description

 The SMKbox riboswitch (also known as SAM-III) is an RNA element that regulates gene expression in bacteria. The SMK box riboswitch is found in the 5' UTR of the MetK gene in lactic acid bacteria. The structure of this element changes upon binding to S-adenosyl methionine (SAM) to a conformation that blocks the shine-dalgarno sequence and blocks translation of the gene. There are other known SAM-binding riboswitches such as SAM-I and SAM-II, but these appear to share no similarity in sequence or structure to SAM-III (from WiKi).


Gene association

Pathways for sulphate assimilation and biosynthesis of cysteine and methionine of Enterococcus faecalis. SAM-III riboswitch (red bar) is involved in multiple gene regulation in the synthetic pathway[1].
drawing


Gene regulation

Translation mechanism of the Enterococcus faecalis SMK box/SAM-III riboswitch, the AUG start codon of metK is indicated in yellow, SD sequence (green) is accessible for translation initiation. We present the prototypical mechanism, but not all possible mechanisms[5].
drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the SAM-III riboswitch. Bottom: Secondary structure depictions of the Enterococcus faecalis SAM-III riboswitch according to PDB ID: 3E5C.

5'GUUCCCGAAAGGAUGGCGGAAACGCCAGAUGCCUUGUAACCGAAAGGGGGAAU3' (Sequence from bottom structure )


3D visualisation

2.25-Å resolution crystal structure of an SAM-III riboswitch from Enterococcus faecalis complexed with S-adenosylmethionine. The figure reference from PDB ID: 3E5C, SAM (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [3].

(Clicking the "Settings/Controls info" to turn Spin off)      
drawing PDBe Molstar






Binding pocket

Left: Surface representation of the binding pocket of the Enterococcus faecalis SAM-III riboswitch generated from PDB ID: 3E5C at 2.25-Å resolution. S-adenosylmethionine (SAM) (shown in sticks) is labeled in red. Right: Hydrogen bonding between SAM and adjacent bases[3].
drawing drawing


Ligand recognition

Chemical structures of various compounds used to probe the binding characteristics of the SAM-III riboswitch. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[6].
drawing



References

[1] The S(MK) box is a new SAM-binding RNA for translational regulation of SAM synthetase.
Fuchs, R. T., Grundy, F. J., & Henkin, T. M.
Nat. Struct. Mol. Biol. 13, 226–233 (2006).

[2] S-adenosylmethionine directly inhibits binding of 30S ribosomal subunits to the S(MK) box translational riboswitch RNA.
Fuchs, R. T., Grundy, F. J., & Henkin, T. M.
Proc. Natl. Acad. Sci. U. S. A. 104, 4876–4880 (2007).

[3] Crystal structures of the SAM-III/S(MK) riboswitch reveal the SAM-dependent translation inhibition mechanism.
Lu, C., Smith, A. M., Fuchs, R. T., Ding, F., Rajashankar, K., Henkin, T. M., & Ke, A.
Nat. Struct. Mol. Biol. 15, 1076–1083 (2008).

[4] Atomistic details of the ligand discrimination mechanism of S(MK)/SAM-III riboswitch.
Priyakumar U. D.
J. Phys. Chem. B 114, 9920–9925 (2010).

[5] The SAM-responsive S(MK) box is a reversible riboswitch.
Smith, A. M., Fuchs, R. T., Grundy, F. J., & Henkin, T. M.
Mol. Microbiol. 78, 1393–1402 (2010).

[6] Variable sequences outside the SAM-binding core critically influence the conformational dynamics of the SAM-III/SMK box riboswitch.
Lu, C., Smith, A. M., Ding, F., Chowdhury, A., Henkin, T. M., & Ke, A.
J. Mol. Biol. 409, 786–799 (2011).

[7] Common themes and differences in SAM recognition among SAM riboswitches.
Price IR, Grigg JC, Ke A.
Biochim Biophys Acta.1839(10):931-938.(2014)

[8] Ligand-induced stabilization of a duplex-like architecture is crucial for the switching mechanism of the SAM-III riboswitch.
Suresh, G., Srinivasan, H., Nanda, S., & Priyakumar, U. D.
Biochemistry 55, 3349–3360 (2016).

[9] Reversible-switch mechanism of the SAM-III riboswitch.
Gong, S., Wang, Y., Wang, Z., Wang, Y., & Zhang, W.
J. Phys. Chem. B 120, 12305–12311 (2016).

[10] Decoding the identification mechanism of an SAM-III riboswitch on ligands through multiple independent gaussian-accelerated molecular dynamics simulations.
Chen, J., Zeng, Q., Wang, W., Sun, H., & Hu, G.
J. Chem. Inf. Model. 62, 6118–6132 (2022).

[11] Structure-based insights into recognition and regulation of SAM-sensing riboswitches.
Zheng L, Song Q, Xu X, Shen X, Li C, Li H, Chen H, Ren A.
Sci China Life Sci.66(1):31-50 (2023).