SAH
Rfam ID: RF01057 (S-adenosyl-L-homocysteine riboswitch)
Click the buttons to navigate to different sections:
Timeline
Description
SAH riboswitches are a kind of riboswitch that bind S-adenosylhomocysteine (SAH). When the coenzyme S-adenosylmethionine (SAM) is used in a methylation reaction, SAH is produced. SAH riboswitches typically up-regulate genes involved in recycling SAH to create more SAM (or the metabolically related methionine). This is particularly relevant to cells, because high levels of SAH can be toxic. Originally identified by bioinformatics, SAH riboswitches are apparent in many species of bacteria, predominantly certain Pseudomonadota and Actinomycetota. The atomic-resolution 3-dimensional structure of an SAH riboswitch has been solved using X-ray crystallography (from WiKi).Gene association
Pathways for sulphate assimilation and biosynthesis of cysteine and methionine of Escherichia coli or Pseudomonas syringae. SAH riboswitch (red bar) is involved in multiple gene regulation in the synthetic pathway[1].
|
Gene regulation
Model of SAH riboswitch sequential folding and translational control in Pseudomonas syringae. We present the prototypical mechanism, but not all possible mechanisms[1].
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for the SAH riboswitch. Bottom: Secondary structure depictions of the plant pathogen Ralstonia solanacearum SAH riboswitch according to PDB ID: 3NPQ.
5'GGACGAGGAGCGCUGCAAGCGAGAGCCCAGGCUCGUCCGUUCAAACGGCGCUCA3' (Sequence from bottom structure )
2.18-Å resolution crystal structure of an SAH riboswitch from Ralstonia solanacearum complexed with S-adenosylmethionine. The figure reference from PDB ID: 3NPQ, SAM (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [3].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
Binding pocket
Left: Surface representation of the binding pocket of the Ralstonia solanacearum SAH riboswitch generated from PDB ID: 3NPQ at 2.18-Å resolution. S-adenosylmethionine (SAM) (shown in sticks) is labeled in red. Right: Hydrogen bonding between SAM and adjacent bases[3].
Ligand recognition
Chemical structures of various compounds used to probe the binding characteristics of the SAH riboswitch. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[3].
|
References
[1] Riboswitches that sense S-adenosylhomocysteine and activate genes involved in coenzyme recycling.
Wang, J. X., Lee, E. R., Morales, D. R., Lim, J., & Breaker, R. R.
Mol. Cell 29, 691–702 (2008).
[2] Riboswitches that sense S-adenosylmethionine and S-adenosylhomocysteine.
Wang, J. X., & Breaker, R. R.
Biochem. Cell Biol. 86, 157–168 (2008).
[3] Structural basis for recognition of S-adenosylhomocysteine by riboswitches.
Edwards, A. L., Reyes, F. E., Héroux, A., & Batey, R. T.
RNA 16, 2144–2155 (2010).
[4] Stimulation of -1 programmed ribosomal frameshifting by a metabolite-responsive RNA pseudoknot.
Chou, M. Y., Lin, S. C., & Chang, K. Y.
RNA 16, 1236–1244 (2010).
[5] Structure-based insights into recognition and regulation of SAM-sensing riboswitches.
Zheng L, Song Q, Xu X, Shen X, Li C, Li H, Chen H, Ren A.
Sci China Life Sci.66(1):31-50 (2023).