PRPP

•

Rfam ID: nan (nan)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:

Timeline Description Structure&recognition References


Timeline

Start

    2004[1] Discovery of ykkC motif that exhibit characteristics of riboswitch function

    Separation of ykkC subtype 2 2017[2]

    2018[3] Identification of ykkC subtype 2b RNAs as PRPP riboswitches, which occur in a tandem arrangement with a guanine aptamer in 127 examples

    Crystal structures of the PRPP riboswitch bound to PRPP 2018[4]

    2018[5] Crystal structures of the PRPP riboswitch bound to PRPP
2023...



Description

 The ykkC RNAs were initially found in 2004 and in 2017,ykkC subtype 2 RNAs were separated from ykkC RNAs. Further analysis of the RNA sequences and consensus models of ykkC subtype 2 RNAs, and the assessment of the diverse types of genes found downstream of these RNAs, revealed that there are probably at least four additional distinct riboswitch classes present within the ykkC subtype 2 collection, termed ykkC subtypes 2a-2d. Phosphoribosyl pyrophosphate (PRPP, 5-phosphoribosyl-1-pyrophosphate) was identified as the ligand for ykkC subtype 2b RNAs (PRPP riboswitches)[1-3].


Gene association

Representatives of PRPP riboswitch commonly associate with genes for de novo purine biosynthesis in bacteria. The genes commonly asssociated with PRPP riboswitches are shown in orange [3].
drawing


Gene regulation

Putative mechanisms for regulation of gene expression by PRPP riboswitches from Heliobacterium modesticaldum. We present the prototypical mechanism, but not all possible mechanisms[3].
drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the PRPP riboswitch. Bottom: Secondary structure depictions of the Thermoanaerobacter mathranii PRPP riboswitch according to PDB ID: 6CK5[4].

5' GUGAAAGUGUACCUAGGGUUCCAGCCUAUUUGUAGGUGUUCGGACCGAGCGGUACAGGUAUAUUUUUAUAUACCACACCUUAGGGACAAAAGCCCGGGAGGAUAGGUUUCACUCGUA 3' (Sequence from bottom structure )


3D visualisation

The overall structure of the Thermoanaerobacter mathranii PRPP riboswitch was generated from PDB ID: 6CK5 at 2.49 Å resolution bound with PRPP. PRPP (shown in sticks) is labeled in red. The metals (M) are colored dark grey. M1 and M3 are modeled as Ba2+, and M2 is modeled as Mg2+. Additional available structures that have been solved and detailed information are accessible on Structures page [4].

(Clicking the "Settings/Controls info" to turn Spin off)      
drawing PDBe Molstar






Binding pocket

Left: Surface representation of the binding pocket of the Thermoanaerobacter mathranii PRPP riboswitch generated from PDB ID: 6CK5 2.49 Å. PRPP (shown in sticks) is labeled in red. Right: The hydrogen bonds and coordination to metal ions of the binding sites of the PRPP riboswitch bound with PRPP. M1 and M3 are modeled as Ba2+, and M2 is modeled as Mg2+[4].
drawing drawing


Ligand recognition

Chemical structures of PRPP (phosphoribosyl pyrophosphate, or 5-phosphoribosyl-1-pyrophosphate). The apparent KD is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[3-5].
drawing



References

[1] New RNA motifs suggest an expanded scope for riboswitches in bacterial genetic control.
Barrick, J. E. et al.
Proc. Natl. Acad. Sci. U. S. A. 101, 6421–6426 (2004).

[2] Metabolism of Free Guanidine in Bacteria Is Regulated by a Widespread Riboswitch Class.
Nelson, J. W., Atilho, R. M., Sherlock, M. E., Stockbridge, R. B. & Breaker, R. R.
Mol. Cell 65, (2017).

[3] Tandem riboswitches form a natural Boolean logic gate to control purine metabolism in bacteria.
Sherlock, M. E., Sudarsan, N., Stav, S. & Breaker, R. R.
Elife 7, (2018).

[4] Structures of two aptamers with differing ligand specificity reveal ruggedness in the functional landscape of RNA.
Knappenberger, A. J., Reiss, C. W. & Strobel, S. A.
Elife 7, (2018).

[5] ykkC riboswitches employ an add-on helix to adjust specificity for polyanionic ligands.
Peselis, A. & Serganov, A.
Nat. Chem. Biol. 14, 887–894 (2018).