NAD+-II

•

Rfam ID: nan (nan)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:

Timeline Description Structure&recognition References


Timeline

Start

    2021[1] Discovery of NAD+-II riboswitch by comparative sequence analysis

    Biochemical validation of NAD+-II riboswitch 2021[2]

    2023[3] Crystal structure of NAD+-II riboswitch

    Crystal structure of NAD+-II riboswitch reveal two distinct ligand-binding pockets 2023[4]
2023...



Description

 NAD+-II riboswitch is the second class of riboswitches that recognize NAD+. It is usually associated with pnuC genes, and PnuC proteins are known to transport nicotinamide riboside (NR), which is a component of the ubiquitous and abundant enzyme cofactor nicotinamide adenine dinucleotide (NAD+). Thus, “pnuC motif” was inferred to function as aptamers for a novel class of NAD+-sensing riboswitches.


Gene association

Schematic representation of PnuC as a NR transporter involved in NAD+ synthesis of Haemophilus influenzae. NAD+-II riboswitch representatives are found exclusively upstream of pnuC genes[2].
drawing


Gene regulation

Potential mechanism of translation regulation by the NAD+-II riboswitch in Streptococcus parasanguinis.The ribosome binding site (RBS) is showed on green. We present the prototypical mechanism, but not all possible mechanisms[4].
drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the NAD+-II riboswitch. Bottom: Secondary structure depictions of the Streptococcus parasanguinis NAD+-II riboswitch according to PDB ID: 8I3Z[2,4].

5'AGAGCGUUGCGUCCGAAAGUCGCC3'. 5'GCGACACGGCUCUUUAAAAACAAAAGGAGAA3' (Sequence from bottom structure )


3D visualisation

Crystal structure of the Streptococcus parasanguinis NAD+-II riboswitch was generated from PDB ID: 8I3Z at 1.67 Å resolution. Additional available structures that have been solved and detailed information are accessible on Structures page [4].

(Clicking the "Settings/Controls info" to turn Spin off)      
drawing PDBe Molstar






Binding pocket

(Left) Surface representation of the binding site 1 and 2 of the Streptococcus parasanguinis NAD+-II riboswitch was generated from PDB ID: 8I3Z at 1.67 Å resolution. NMN (shown in sticks) is labeled in red. (Right) The hydrogen bonds of the two binding sites of the NAD+-II riboswitch bound with NMN[4].
drawing drawing


References

[1] Comprehensive discovery of novel structured noncoding RNAs in 26 bacterial genomes
Brewer, K. I. et al.
RNA Biol. 18, 2417–2432 (2021).

[2] A second riboswitch class for the enzyme cofactor NAD
Panchapakesan, S. S. S., Corey, L., Malkowski, S. N., Higgs, G. & Breaker, R. R.
RNA 27, 99–105 (2021).

[3] Structure-based investigations of the NAD+-II riboswitch
Xu, X. et al.
Nucleic Acids Res. 51, 54–67 (2023).

[4] Crystal structures of the NAD+-II riboswitch reveal two distinct ligand-binding pockets
Peng, X., Liao, W., Lin, X., Lilley, D. M. J. & Huang, L.
Nucleic Acids Res. 51, 2904–2914 (2023).