Adenine

•

Rfam ID: RF00167 (Purine riboswitch)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:

Timeline Description Structure&recognition References


Timeline

Start

    1997[1] Discovery of xpt-pbuX operon

    Discovery of the adenine riboswitch 2004[3]

    2004[4] Crystal structures of add adenine riboswitch bound to adenine

    The function of adenine riboswitch depends on the relative rates of ligand binding and the transcriptional process 2006[6]

    2010[7] Crystal structures of the U65C mutant ydhL adenine riboswitch in ligand-free state

    Cotranscriptional folding in an adenine riboswitch directs the gene-regulatory transcription outcome 2012[8]

    2017[9] Four structures of the add adenine riboswitch during the course of a reaction were determined using femtosecond X-ray free electron laser (XFEL) pulses

    Characterization of the ligand-dependent conformational dynamics of the full-length add adenine riboswitch by NMR and single-molecule FRET (smFRET) spectroscopy 2017[10]

    2021[11] The add adenine riboswitch relies on the folding of a structural intermediate that pre-organizes the aptamer global structure and the ligand binding site to allow efficient metabolite sensing and riboswitch genetic regulation

    Using adenine riboswitch as an initial aptamer-like RNA to engineer well-folded cell-compatible fluorogenic aptamers and devices 2022[12]
2023...



Description

 Carrying an aptamer domain similar in sequence and secondary structure to the guanine riboswitch, the adenine riboswitch selectively recognizes adenine, and contains a uracil ribonucleotide in position 74 of the adenine-binding aptamer domain. in Bacillus subtilis ydhL (also called pbuE) and two RNAs (add genes) from Clostridium perfringens and Vibrio vulnificus harbor adenine riboswitches in their mRNA elements. The ydhL adenine riboswitch has been shown to control gene expression through transcriptional activation, while the add adenine riboswitch controls gene expression through translational activation[3,4].


Gene association

Purine salvage, interconversion, and catabolic pathways in Bacillus subtilis. It has been demonstrated that the ydhL gene, encoding for the putative purine efflux pump, and the add gene, encoding for adenine deaminase[1-4].
drawing


Gene regulation

Mechanisms for regulation of gene expression by adenine riboswitches in Bacillus subtilis. The Shine-Dalgarno GAA sequence and the initiation codon are shaded in orange and blue respectively. We present the prototypical mechanism, but not all possible mechanisms[3,4].
drawing drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the adenine riboswitch. Bottom: Secondary structure depictions of the adenine riboswitch in Bacillus subtilis according to PDB ID: 1Y26[4].

5' CGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUG 3' (Sequence from bottom structure )


3D visualisation

The overall structure of the Bacillus subtilis adenine riboswitch was generated from PDB ID: 1Y26 at 2.10 Å resolution bound with adenine. Adenine (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [4].

(Clicking the "Settings/Controls info" to turn Spin off)      
drawing PDBe Molstar






Binding pocket

Left: Surface representation of the binding pocket of the Bacillus subtilis adenine riboswitch in generated from PDB ID: 1Y26 at 2.10 Å. Adenine (shown in sticks) is labeled in red. Right: The hydrogen bonds of the binding sites of the adenine riboswitch bound with adenine[4].
drawing drawing


Ligand recognition

Chemical structures of adenine and its analogs. The apparent KD of each compound of the ydhL adenine riboswitch is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[3].
drawing



References

[1] Xanthine metabolism in Bacillus subtilis: characterization of the xpt-pbuX operon and evidence for purine- and nitrogen-controlled expression of genes involved in xanthine salvage and catabolism.
Christiansen, L. C., Schou, S., Nygaard, P. & Saxild, H. H.
J. Bacteriol. 179, (1997).

[2] Definition of a second Bacillus subtilis pur regulon comprising the pur and xpt-pbuX operons plus pbuG, nupG (yxjA), and pbuE (ydhL).
Johansen, L. E., Nygaard, P., Lassen, C., Agersø, Y. & Saxild, H. H.
J. Bacteriol. 185, (2003).

[3] Adenine riboswitches and gene activation by disruption of a transcription terminator.
Mandal, M. & Breaker, R. R.
Nat. Struct. Mol. Biol. 11, (2004).

[4] Structural Basis for Discriminative Regulation of Gene Expression by Adenine- and Guanine-Sensing mRNAs.
Serganov, A. et al.
Chem. Biol. 11, (2004).

[5] The Kinetics of Ligand Binding by an Adenine-Sensing Riboswitch.
Wickiser, J. K., Cheah, M. T., Breaker, R. R. & Crothers, D. M.
Biochemistry 44, (2005).

[6] Folding of the Adenine Riboswitch.
Lemay, J. F., Penedo, J. C., Tremblay, R., Lilley, D. M. & Lafontaine, D. A.
Chem. Biol. 13, (2006).

[7] Riboswitch structure: an internal residue mimicking the purine ligand.
Delfosse, V. et al.
Nucleic Acids Res. 38, (2010).

[8] Direct observation of cotranscriptional folding in an adenine riboswitch.
Frieda, K. L. & Block, S. M.
Science 338, (2012).

[9] Structures of riboswitch RNA reaction states by mix-and-inject XFEL serial crystallography.
Stagno, J. R. et al.
Nature 541, (2017).

[10] Ligand-modulated folding of the full-length adenine riboswitch probed by NMR and single-molecule FRET spectroscopy.
Warhaut, S. et al.
Nucleic Acids Res. 45, 5512–5522 (2017).

[11] A structural intermediate pre-organizes the add adenine riboswitch for ligand recognition.
St-Pierre, P. et al.
Nucleic Acids Res. 49, (2021).

[12] Repurposing an adenine riboswitch into a fluorogenic imaging and sensing tag.
Dey, S. K. et al.
Nat. Chem. Biol. 18, 180–190 (2022).